VIRsiRNAid | siRNA Sequence | Virus_Name | Target Region | Cell Line | Test Object | Efficacy | PMID | Offtarget | Align With | ALIGN0 Result |
virsi2323 | gggcaaugguugugggcua | Dengue Virus [DENV] | E | Huh-7 | Plaque Count | High | 21795337 | Blast SL | refseqs |       | Pubmed:
21795337 Article:
Inhibition of dengue virus infections in cell cultures and in AG129 mice by an siRNA targeting a highly conserved sequence. Stein DA, Perry ST, Buck MD, Oehmen CS, Fischer MA, Poore E, Smith JL, Lancaster AM, Hirsch AJ, Slifka MK, Nelson JA, Shresta S, Fraceh K. J Virol. 2011 Jul 27. [Epub ahead of print] J Virol. 2011 21795337
Authors:
Journal:
Entrez:
virsi1506 | ggauguggauuauuuggaa | Dengue Virus [DENV] | E | BHK-21 | Cell Count | 92 | 20015996 | Blast SL | refseqs |       | Pubmed:
20015996 Article:
Targeted delivery of small interfering RNA to human dendritic cells to suppress dengue virus infection and associated proinflammatory cytokine production.Authors:
Subramanya S, Kim SS, Abraham S, Yao J, Kumar M, Kumar P, Haridas V, Lee SK, Shultz LD, Greiner D, N M, Shankar P.Journal:
J Virol. 2010 Mar;84(5):2490-501. Epub 2009 Dec 16.Entrez:
20015996
virsi1505 | cauagaagcagaaccucca | Dengue Virus [DENV] | E | BHK-21 | Cell Count | 85 | 20015996 | Blast SL | refseqs |       | Pubmed:
20015996 Article:
Targeted delivery of small interfering RNA to human dendritic cells to suppress dengue virus infection and associated proinflammatory cytokine production.Authors:
Subramanya S, Kim SS, Abraham S, Yao J, Kumar M, Kumar P, Haridas V, Lee SK, Shultz LD, Greiner D, N M, Shankar P.Journal:
J Virol. 2010 Mar;84(5):2490-501. Epub 2009 Dec 16.Entrez:
20015996
virsi1504 | acacaacauggaacaauag | Dengue Virus [DENV] | E | BHK-21 | Cell Count | 83 | 20015996 | Blast SL | refseqs |       | Pubmed:
20015996 Article:
Targeted delivery of small interfering RNA to human dendritic cells to suppress dengue virus infection and associated proinflammatory cytokine production.Authors:
Subramanya S, Kim SS, Abraham S, Yao J, Kumar M, Kumar P, Haridas V, Lee SK, Shultz LD, Greiner D, N M, Shankar P.Journal:
J Virol. 2010 Mar;84(5):2490-501. Epub 2009 Dec 16.Entrez:
20015996
virsi1502 | augaagagcaggacaaaag | Dengue Virus [DENV] | E | BHK-21 | Cell Count | 71 | 20015996 | Blast SL | refseqs |       | Pubmed:
20015996 Article:
Targeted delivery of small interfering RNA to human dendritic cells to suppress dengue virus infection and associated proinflammatory cytokine production.Authors:
Subramanya S, Kim SS, Abraham S, Yao J, Kumar M, Kumar P, Haridas V, Lee SK, Shultz LD, Greiner D, N M, Shankar P.Journal:
J Virol. 2010 Mar;84(5):2490-501. Epub 2009 Dec 16.Entrez:
20015996
virsi1503 | auuggauacagaaagagac | Dengue Virus [DENV] | E | BHK-21 | Cell Count | 0 | 20015996 | Blast SL | refseqs |       | Pubmed:
20015996 Article:
Targeted delivery of small interfering RNA to human dendritic cells to suppress dengue virus infection and associated proinflammatory cytokine production.Authors:
Subramanya S, Kim SS, Abraham S, Yao J, Kumar M, Kumar P, Haridas V, Lee SK, Shultz LD, Greiner D, N M, Shankar P.Journal:
J Virol. 2010 Mar;84(5):2490-501. Epub 2009 Dec 16.Entrez:
20015996
virsi2276 | ggcugaucaacaccaacggca | Hepatitis C Virus [HCV] | E | Huh-7 | mRNA | 93 | 21535893 | Blast SL | refseqs |       |
virsi2277 | ggcgcagcuucgacgucauau | Hepatitis C Virus [HCV] | E | Huh-7 | mRNA | 87 | 21535893 | Blast SL | refseqs |       |
virsi1965 | cauaucuaggugcuggacc | Hepatitis C Virus [HCV] | E | Huh-7 | mRNA | 83 | 21161551 | Blast SL | refseqs |       |
virsi2275 | gguugguucgguuguaccugg | Hepatitis C Virus [HCV] | E | Huh-7 | mRNA | 80 | 21535893 | Blast SL | refseqs |       |
virsi1968 | guucaacucuacuggaugu | Hepatitis C Virus [HCV] | E | Huh-7 | mRNA | 75 | 21161551 | Blast SL | refseqs |       |
virsi1971 | uacaccuccaccaaaacau | Hepatitis C Virus [HCV] | E | Huh-7 | mRNA | 74 | 21161551 | Blast SL | refseqs |       |
virsi1970 | caacugagcuugccauacu | Hepatitis C Virus [HCV] | E | Huh-7 | mRNA | 73 | 21161551 | Blast SL | refseqs |       |
virsi1966 | gccuucacauucagaccuc | Hepatitis C Virus [HCV] | E | Huh-7 | mRNA | 70 | 21161551 | Blast SL | refseqs |       |
virsi2278 | ggcucgaguauuguguacgag | Hepatitis C Virus [HCV] | E | Huh-7 | mRNA | 66 | 21535893 | Blast SL | refseqs |       |
virsi1967 | uggcuugggauaugaugau | Hepatitis C Virus [HCV] | E | Huh-7 | mRNA | 60 | 21161551 | Blast SL | refseqs |       |
virsi1969 | cauccccugcugcauucaa | Hepatitis C Virus [HCV] | E | Huh-7 | mRNA | 55 | 21161551 | Blast SL | refseqs |       |
virsi1498 | ggauguggacuuuucggga | Japanese Encephalitis Virus [JE] | E | Monkey Kidney Cells | Viral Load | 90 | 16464133 | Blast SL | refseqs |       |
virsi1499 | gggagcauugacacaugugca | Japanese Encephalitis Virus [JE] | E | Monkey Kidney Cells | Viral Load | 90 | 16464133 | Blast SL | refseqs |       |
virsi1228 | cggcauacagcuucaacug | St. Louis Encephalitis [SLE] | E | BHK-21 | Cell Count | 75 | 21423625 | Blast SL | refseqs |       |
virsi1497 | ggcugcggacuguuuggaa | West Nile Virus [WNV] | E | Monkey Kidney Cells | Cell Count | 100 | 16464133 | Blast SL | refseqs |       |
virsi2197 | agagguccgcaguuauugc | West Nile Virus [WNV] | E | Vero | mRNA | 90 | 19135091 | Blast SL | refseqs |       |
virsi1491 | gcugcgugacuaucauguc | West Nile Virus [WNV] | E | Vero | Viral Load | 76 | 15747251 | Blast SL | refseqs |       |
virsi1488 | ggagugucuggagcaacau | West Nile Virus [WNV] | E | HTB Cells | Cell Count | 65 | 18360908 | Blast SL | refseqs |       |
virsi1492 | ugacaaacgugcugaccca | West Nile Virus [WNV] | E | Vero | Viral Load | 62 | 15747251 | Blast SL | refseqs |       |